| |
|
|
| Year : 2014 | Volume
: 25
| Issue : 1 | Page : 45-49 |
|
| MSX 1 gene variant and non-syndromic clefting: Association or rejection? |
|
|
Naveen Admala Reddy, Adusumilli Gopinath, JayaprakashThirumala Reddy, Raghu Devanna, Pichai Saravanan, Mayur G Rohra
Departments of Orthodontics, and Dentofacial Orthopaedics, AME's Dental College, Hospital and Research Center, Raichur, Karnataka, India
Click here for correspondence address and email
| Date of Submission | 28-Nov-2012 |
| Date of Decision | 09-Apr-2013 |
| Date of Acceptance | 12-Jun-2013 |
| Date of Web Publication | 21-Apr-2014 |
|
|
 |
|
 Abstract | | |
Context: Non-syndromic cleft lip/palate (NSCL/P) is a congenital anomaly with significant medical, psychological and social ramifications. There is sufficient evidence to hypothesize that locus for this condition can be identified by candidate genes.
Aims: The aim of this study is to amplify the chosen region (799 G >T) of MSX 1 gene, investigate the degree of association and perform a mutation research from Raichur cleft lip and palate patient sample.
Settings and Design: Case history and clinical examination of the patient were recorded to rule. Written consent was obtained from patients and controls for in vivo study.
Study was designed in four steps as follows:
- Collection of a blood sample
- Genomic deoxyribonucleic acid (DNA) extraction
- Polymerase chain reaction (PCR)
- Restriction fragment length polymorphism (RFLP).
Materials and Methods: Blood samples were collected from 50 subjects having NSCL/P and 50 controls. Genomic DNA was extracted, PCR and RFLP was performed for digestion products that were evaluated.
Statistical Analysis: Chi-square test with P value at 95% confidence intervals.
Results: The results showed a positive correlation between MSX 1 799 G >T gene variant and NSCL/P patients in Raichur patients.
Conclusions: From a genetically diverse etiology MSX 1 799 G >T gene variant may be a good screening marker for NSCL/P in Raichur patients.Keywords: MSX 1 gene, non-syndromic clefting, polymerase chain reaction
How to cite this article:
Reddy NA, Gopinath A, Reddy J, Devanna R, Saravanan P, Rohra MG. MSX 1 gene variant and non-syndromic clefting: Association or rejection?. Indian J Dent Res 2014;25:45-9 |
How to cite this URL:
Reddy NA, Gopinath A, Reddy J, Devanna R, Saravanan P, Rohra MG. MSX 1 gene variant and non-syndromic clefting: Association or rejection?. Indian J Dent Res [serial online] 2014 [cited 2023 Sep 23];25:45-9. Available from: https://www.ijdr.in/text.asp?2014/25/1/45/131054 |
The development of the head and face is one of the most complex and tightly controlled events during the embryonic development. Disturbances during the period critical for the formation of face (7-10 weeks for humans) may lead to orofacial clefts. [1] Non-syndromic cleft lip with or without cleft palate (NSCL/CLP) is the most common craniofacial anomaly. Its birth prevalence ranges from 1/500 to 1/2000, depending upon geographical origin. Approximately, two-thirds of the cases are not accompanied by other anomalies and are called non-syndromic (NS). [2]
It is very likely that both genetic and environmental factors contribute to this malformation. Genetic factors contribute approximately 30% toward cleft lip and palate, whereas environmental factors are the major contributors approximately 70% of cleft lip and palate. It has been reported that cleft lip and palate occurs more frequently in males while the sex bias is reversed for cleft palate, which is more common in females. [3] The etiology seems complex, but genetics plays a major role.
Over the past decade, genetic linkage and association analyses have provided evidence to support the involvement of several genes and chromosomal regions, among them loci at 1q32 (IRF 6 ), 2p13 (TGFA), 4p16 (MSX 1 ), 6p23-25, 14q24 (TGFB 3 ), 17q21 (RARA) and 19q13 (BCL 3 , TGFB 1 ) have the most supporting data. [4]
MSX 1 is located on human chromosome 4p16. The MSX 1 homeobox gene, which is also expressed in the facial primordia, is required for expression of Bmp2 and Bmp4 in the palatal mesenchyme and Sonic Hedgehog (Shh) in the medial edge epithelium (MEE). Shh plays a significant role in the early induction of facial primordia in addition to expression in the palatal MEE. Bmp2 and Bmp4 on the other hand, are expressed more specifically within the epithelia and mesenchyme of the palatal shelves. [3] The mutations and polymorphisms of MSX 1 have been shown to be diverse. One of variation for MSX 1 is 799 G > T (G267C).
The advents of molecular biology and advanced genetic techniques have allowed uncovering, characterizing and ultimately manipulating the genes that make up the genome. It is becoming clear that the molecular center of embryogenic morphology resides at the level of gene.
Hence, the aim of this study is to derive an association between MSX 1 799 G > T (G267C) gene variant and NSCL with or without cleft palate in the Raichur district with the use of polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) with the restriction enzyme Desulfovibrio desulfuricans  (DdEI).
| Materials and Methods | |  |
Source of data
This genetic study was conducted in an Institution on the people of Raichur district having NSCL and palate as cases.
Method of selection of data
Inclusion criteria of patients
Patient having NSCL with or without cleft palate.
Inclusion criteria of controls
Subjects should not possess family history of the cleft lip with or without palate, any syndromes related to cleft lip with or without palate and any history of developmental disabilities, including learning disabilities and attention deficits, hearing impairment and speech deficits or abnormalities. [5],[6]
Exclusion criteria of patients
Patients having cleft lip/palate associated with any history of developmental disabilities, including learning disabilities and attention deficits, hearing impairment and speech deficits or abnormalities. [5],[6]
Exclusion criteria of controls
Subjects that possess family history of the cleft lip with or without palate, any syndromes related to the cleft lip with or without palate and any history of developmental disabilities, including learning disabilities and attention deficits, hearing impairment and speech deficits or abnormalities. [5],[6]
Sample size
Group A
A total of 50 subjects with NSCL, with or without Palate reporting to the cleft clinics of Department of Orthodontics and Dentofacial Orthopedics, AME'S Dental College, Hospital and Research Center from Raichur district.
Group B
A total of 50 unrelated control subjects reporting to the Department of Orthodontics and Dentofacial Orthopedics, AME'S Dental College, Hospital and Research Center from Raichur district.
Methodology
The study was carried out in Department of Orthodontics and Dentofacial Orthopedics, AME'S Dental College, Hospital and Research Center after approval from institutional ethical committee and guidelines from Helsinki declaration were followed. Informed written consent was taken from the respective subjects. A study was conducted on 50 NSCL with or without cleft palate patients and 50 unrelated control subjects. As pre-operative evaluations, all patients were screened for the presence of associated anomalies or syndromes by a geneticist and only those determined to have isolated cleft lip with or without cleft palate were included in the study.
The study was performed in four steps:
Collection of blood samples
A total volume of 2 ml venous blood samples were obtained from both Group A and Group B and collected in ethylenediaminetetraacetic acid vials and transported in ice box unit [Figure 1], [Figure 2], [Figure 3]. | Figure 2: Blood sample collected in ethylenediaminetetraacetic acid vials
Click here to view |
Genomic deoxyribonucleic acid (DNA) extraction
Genomic DNA was extracted from the blood of the cases and control subjects by using ethanol and chloroform protocol [Figure 4] and [Figure 5]. Once the isolated genomic DNA precipitate was obtained, it was used as a template for the PCR test.
PCR
Precipitated genomic DNA was amplified using the PCR with primers: [7]
- MSX 1 F: 5′GGCTGATCATGCTCCAATGC3′
- MSX 1 R: 5′CAGGAAACAGCTATGACCCTGGAAG GGGCCAGAGGCTC3'
Giving a PCR product of 448 bases pairs (bp). The PCR product (448 [bp]) that was obtained was run on 1.5% agarose gel containing ethidium bromide to assess the initial amplified PCR products [Figure 6].
RFLP
Genotyping for the MSX 1 799 G > T gene variant was carried out by restriction digestion of PCR products with DdEI (from Desulfovibrio desulfuricans). [7] The digested PCR products were separated into channels on a 1.5% agarose gel containing ethidium bromide in an electrophoretic chamber [Figure 7] and [Figure 8]. An ultraviolet transilluminator was used to see the specific bands of base pairs of the digested PCR products. | Figure 4: Genomic deoxyribonucleic acid extraction of cases with chloroform ethanol protocol
Click here to view |
 | Figure 5: Genomic deoxyribonucleic acid extraction of controls with chloroform ethanol protocol
Click here to view |
Statistical analysis
The statistics for this study were computed using the statistical software SPSS (Statistical Package for the Social Sciences), version 17.0, Chicago, IL, USA). Chi-square test was employed for statistical analysis [Figure 7].
| Results | | |
The following results were obtained from the descriptive data and the statistical comparisons:
Descriptive data
The initial PCR product of the MSX 1 gene was obtained for the 50 subjects. The size of this PCR product was 448 bp [Figure 6]. After obtaining the initial PCR products of MSX 1 gene (448 bp) from Groups A and B, samples were then subjected to digestion with the specific restriction enzyme DdEI. After digestion, the 448 bp products were completely digested with two restriction sites and three specific bands at 220, 181 and 150 bp in 44 subjects of Group A [Figure 7], whereas 46 subjects in Group B showed incomplete/no digestion [Figure 8]. Hence, the presence of variant was shown only in 44 subjects of Group A and 4 subjects in Group B.
Statistical comparisons
Chi-square test was employed for statistical analysis that gave a P value of < 0.005 at 95% confidence intervals. The odds value was 84.3 [Figure 9].
The descriptive data and statistical comparisons demonstrate a significant association between MSX 1 799 G > T (G267C) gene variant and NSCL with or without cleft palate in Raichur patients.
| Discussion | | |
Identification of the genes involved in the development of the human craniofacial region can serve as a first step towards developing a better understanding of diagnosis, treatment and preventions of developmental anomalies of this regions. [8] The genetic background of NSCL/P is complex and most causes remain yet to be identified.
The mammalian MSX gene family consists of 3 physically unlinked members, named MSX 1 , MSX 2 and MSX 3 . However in developing vertebrate embryos, MSX 1 and MSX 2 are widely expressed at the sites where epithelial mesenchymal interactions take place. [9] The process of palatal fusion is also controlled by interactive signaling from the mesenchyme to the epithelium, which is mediated by growth factors and extracellular matrix proteins. One of the key components in this process is MSX 1 expression, which coordinates palatogenesis. The regulation of MSX gene expression is accomplished by diverse mechanisms involving retinoids, antisense "quenching," growth factor regulation and complementary/antagonistic interaction with other transcription factors. This reduced activity of MSX 1 due to genetic variation may increase the risk for oral clefts.
Two previous studies supported that only 2% contribution of MSX 1 to NS clefting. [7] A candidate gene-based association study reported a significant linkage disequilibrium between both CLP and CP with polymorphisms in MSX 1 . In the same report, a cohort of NSCL/P patients were analyzed for coding region mutations without success. [10]
In this study, the presence of MSX 1 799 G > T (G267C) gene variant in a sample of 50 subjects was assessed. A significant association was seen in Group A subjects with MSX 1 gene variant as compared with the controls. These findings suggest that these gene variants have a role in the etiology of NSCL/P in our population. In Group B, it was observed that there was no significant association with the gene variant. Hence, this suggest that MSX 1 799 G > T gene variant is positively associated with NSCL and palate in Raichur district. However, there is a possibility of involvement of other genes as NSCL/P is of polygenic nature and studies suggest that other genes such as TGFB3, RARA, BCLX3, TGFαA, MTHR, PVLRI are involved in the etiology of NSCL/P. [1],[11]
| Conclusion | | |
This study indicates that there is a strong association between the presence of MSX 1 799 G > T (G267C) gene variant with the incidence of NSCL and palate and it may act as a genetic marker for NSCL and palate in this population.
Studies about such genetic markers of NSCL and palate will help us to predict and target at the molecular level in treating such problems. A major challenge is not only a complete cataloguing of all such genes involved in the etiology of NSCL/P, but identification of their polygenetic nature to have a thorough understanding of the craniofacial development. The future challenge is to bring this new knowledge from the "level of PCR sequencer into the clinical realms."
| References | | |
| 1. | Morkuniene A, Steponaviciute D, Ambrozaityte L, Utkus A, Linkeviciane L, Kucinskas V. TGFA, TGFB3, GABRB3, RARA and BCL3 loci associated with nonsyndromic orofacial clefts? A Lithuanian study. Biologija 2007;18:1-6. 
|
| 2. | Wong FK, Hagg U. An update on the aetiology of orofacial clefts. Hong Kong Med J 2004;10:331-6.
|
| 3. | Stanier P, Moore GE. Genetics of cleft lip and palate: Syndromic genes contribute to the incidence of non-syndromic clefts. Hum Mol Genet 2004;13 Spec No 1:R73-81.
|
| 4. | Association between IRF6, MSX1 SNPs and nonsyndromic cleft lip with or without cleft palate in the West Chinese population (online). Available from: http://www.china-papers.com/?p=80224. [2010 Mar 7 cited].
|
| 5. | Mitchell LE, Beaty TH, Lidral AC, Munger RG, Murray JC, Saal HM, et al. Guidelines for the design and analysis of studies on nonsyndromic cleft lip and cleft palate in humans: Summary report from a workshop of the international consortium for oral clefts genetics. Cleft Palate Craniofac J 2002;39:93-100.
|
| 6. | Khoury MJ, Flanders WD. Nontraditional epidemiologic approaches in the analysis of gene-environment interaction: Case-control studies with no controls! Am J Epidemiol 1996;144:207-13.
|
| 7. | Tongkobpetch S, Siriwan P, Shotelersuk V. MSX1 mutations contribute to nonsyndromic cleft lip in a Thai population. J Hum Genet 2006;51:671-6.
|
| 8. | Chang H, Brown CW, Matzuk MM. Genetic analysis of the mammalian transforming growth factor-beta superfamily. Endocr Rev 2002;23:787-823.
|
| 9. | Alappat S, Zhang ZY, Chen YP. Msx homeobox gene family and craniofacial development. Cell Res 2003;13:429-42.
|
| 10. | Lidral AC, Romitti PA, Basart AM, Doetschman T, Leysens NJ, Daack-Hirsch S, et al. Association of MSX1 and TGFB3 with nonsyndromic clefting in humans. Am J Hum Genet 1998;63:557-68.
|
| 11. | Jagomägi T, Nikopensius T, Krjutskov K, Tammekivi V, Viltrop T, Saag M, et al. MTHFR and MSX1 contribute to the risk of nonsyndromic cleft lip/palate. Eur J Oral Sci 2010;118:213-20.
|
Correspondence Address:
Mayur G Rohra
Departments of Orthodontics, and Dentofacial Orthopaedics, AME's Dental College, Hospital and Research Center, Raichur, Karnataka
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/0970-9290.131054
[Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6], [Figure 7], [Figure 8], [Figure 9] |
|
|
|
|
|
|
|
|
|
|
|
|
|
| Article Access Statistics | | | Viewed | 6039 | | | Printed | 443 | | | Emailed | 0 | | | PDF Downloaded | 118 | | | Comments | [Add] | | |
|
|
Users online:
