| |
|
|
| Year : 2010 | Volume
: 21
| Issue : 3 | Page : 341-348 |
|
| The use of ozonated water and 0.2% chlorhexidine in the treatment of periodontitis patients: A clinical and microbiologic study |
|
|
Durga Kshitish, Vandana K Laxman
Department of Periodontics, College of Dental Sciences, Davangere, Karnataka, India
Click here for correspondence address and email
| Date of Submission | 01-Oct-2009 |
| Date of Decision | 12-Nov-2009 |
| Date of Acceptance | 21-May-2010 |
| Date of Web Publication | 29-Sep-2010 |
|
|
 |
|
 Abstract | | |
Background: The development of periodontal disease has been thought to be associated with several restricted members of the oral anaerobic species, such as black-pigmented Porphyromonas species and Actinobacillus actinomycetemcomitans (Aa), in the subgingival environment. Apart from bacteria, certain viruses and fungi that are associated with periodontal disease are also present in the subgingival plaque .
Materials and Methods: A randomized, double-blind, crossover split-mouth design was performed. A total of 16 patients suffering from generalized chronic periodontitis were selected for the study. The study period of 18 days was divided into two time-intervals, i.e. baseline (0 days) to 7 th day, with a washout period of 4 days followed by a second time interval of 7 days. The use of ozone and chlorhexidine gluconate (CHX) irrigation was randomized. Both the patient and the clinician evaluating the clinical parameters were blinded regarding the type of irrigation used.
Results: The interpretation of clinical and microbial data is from baseline to 7 th day. A higher percentage of plaque index (12%), gingival index (29%) and bleeding index (26%) reduction was observed using ozone irrigation as compared to chlorhexidine. The percentile reduction of Aa (25%) using ozone was appreciable as compared to no change in Aa occurrence using chlorhexidine. By using O 3 and chlorhexidine, there was no antibacterial effect on Porphyromonas gingivalis (Pg) and Tannerella forsythensis. The antifungal effect of ozone from baseline (37%) to 7 th day (12.5%) was pronounced during the study period, unlike CHX, which did not demonstrate any antifungal effect.
Conclusion: Ozone may be considered as an alternative management strategy due to its powerful ability to inactivate microorganisms. Also, there is growing evidence that ozone can be employed as a useful therapeutic agent in both dentistry and medicine. Keywords: Bacteria, chlorhexidine, fungus, ozone, single irrigation, viruses
How to cite this article:
Kshitish D, Laxman VK. The use of ozonated water and 0.2% chlorhexidine in the treatment of periodontitis patients: A clinical and microbiologic study. Indian J Dent Res 2010;21:341-8 |
How to cite this URL:
Kshitish D, Laxman VK. The use of ozonated water and 0.2% chlorhexidine in the treatment of periodontitis patients: A clinical and microbiologic study. Indian J Dent Res [serial online] 2010 [cited 2023 Sep 22];21:341-8. Available from: https://www.ijdr.in/text.asp?2010/21/3/341/70796 |
The development of periodontal disease has been thought to be associated with several restricted members of oral anaerobic species, such as black-pigmented Porphyromonas species and Actinobacillus actinomycetemcomitans  itans (Aa), in the subgingival environment. Apart from bacteria, certain viruses and fungi are also present in the subgingival plaque that have been associated with periodontal disease. The involvement of Herpes viruses in the etiology of periodontal diseases was suggested by their presence in the gingival tissue, gingival crevicular fluid and subgingival plaque, in the presence of periodontal disease. [1] Candida albicans has been recovered from periodontal pockets in a large number of patients with chronic periodontitis and had been found to be invading the gingival connective tissue in patients with juvenile periodontitis. [2]
Removal of dental plaque thus forms an important part of controlling and treating periodontal disease, which brings about both qualitative as well as quantitative changes in the subgingival microflora. A number of chemical adjuncts have been used to improve the outcome of mechanical oral hygiene procedures, one of which is chlorhexidine, a broad-spectrum antiseptic with pronounced antimicrobial effects on Gram-positive as well as Gram-negative bacteria, some viruses and fungi. [3],[4]
One inference of the ecological plaque hypothesis is that disease might be prevented not only by inhibiting the putative pathogens but also by interfering with the factors responsible for the transition of the plaque microflora from the commensal to a pathogenic relationship with the host. [5] The early studies confirm the theoretical basis of the ecological plaque hypothesis by showing that a preventing strategy that interferes with critical event in the breakdown of microbial homeostasis in plaque can shift the ecological balance of plaque back toward one that is compatible with dental health. [6]
A consideration of the principles behind the ecologic plaque hypothesis can lead to the identification of new strategies to prevent disease and offer new perspectives on existing approaches. Thus, the preventing strategies based on the ecological plaque hypothesis include altering the subgingival environment by various methods, which also includes the application of oxygenating and redox agents. [7]
An alternative approach to conventional antimicrobial or antiseptic agents in the suppression of subgingival bacteria is to inhibit their growth by changing the subgingival environment, which has been shown to be highly anaerobic with a prevailing low oxygen tension. [8] First advocated by Dunlop in 1913, various agents such as molecular oxygen, [9] hyperbaric oxygenation [10] and hydrogen peroxide have been applied. [11] It has been shown that repeated subgingival oxygen irrigation in previously untreated deep periodontal pockets resulted in a significant clinical improvement of the periodontal baseline conditions. [12] Recently, ozone therapy is gaining popularity in various treatment modalities in the field of medicine, dentistry, veterinary, food industry, water treatment, etc. In dentistry, ozone is being successfully utilized for the treatment of dental caries.
Although ozone has been shown to be detrimental against bacteria, viruses, fungi and protozoa in vitro, less attention has been paid to the antibacterial, antiviral and antifungal properties of ozonated water on periodontopathic microorganisms in vivo. Currently, the established oral antiseptics for periodontal treatment include chlorhexidine gluconate (CHX, 0.2-2%). Regarding side-effects, it is known that chlorhexidine may cause mucosal desquamation, impaired wound healing and fibroblast attachment to the tooth surfaces, tooth staining and altered taste sensation. In proposing ozone as another potential antimicrobial for use in the oral cavity, it is important to compare its potential with that of the potential of established agents . Ozone is currently being discussed in dentistry as a possible alternative antiseptic agent. Its high antimicrobial power without the development of drug resistance has been noted in water purification and food preservation. Recent investigations have reported antimicrobial effects on oral pathogens of both gaseous and aqueous forms of ozone, and the effectiveness of ozone in the treatment of oral diseases is currently a subject of intense research. [13]
The MEDLINE search revealed lack of periodontal literature on the effects of ozone on clinical parameters of periodontal inflammation. In vivo antibacterial, antiviral and antifungal effect of ozone has been attempted for the first time in this preliminary clinical trial. Hence, the aim of the present study was to evaluate the effect of oral irrigation with ozonated water and 0.2% chlorhexidine in moderately deep periodontal pockets on the clinical parameters and microbial profile in subgingival plaque of chronic and aggressive periodontitis.
Hence, the objectives of the study include evaluation and comparison of the effects of oral irrigation with ozonated water and 0.2% chlorhexidine on clinical parameters such as Plaque Index, Gingival Index and Gingival Bleeding Index. A second objective of the study was to assess and compare the effects of oral irrigation with ozonated water and 0.2% chlorhexidine on microorganisms such as bacteria, including Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis and Tannerella forsythensis (Tf), viruses such as Herpes simplex virus (HSV-1 and 2), Human Cytomegalo-virus (HCMV) and Epstein Baar virus (EBV), and the fungus, Candida albicans.
| Materials and Methods | |  |
The subjects for this study were selected from the Out-Patient Department of Periodontics, College of Dental Sciences, Davangere, Karnataka. Patients of both sexes within the age limit of 20-60 years were included in the study.
A randomized, double-blind, crossover split-mouth design was performed. A total of sixteen patients suffering from generalized chronic and aggressive periodontitis were selected for the study. Patients who were pregnant or lactating; suffering from any known systemic diseases, who had received any surgical or non-surgical therapy 6 months prior to the start of the study, who had received any antibiotic therapy in the last 6 months, who had received any chemotherapeutic mouth rinses and oral irrigation during the past 6 months and who were smokers were excluded from the study. Ethical clearance was obtained from the ethical committee of the College of Dental Sciences, Davangere, India. Data collection was performed between August 2006 and October 2006. All participants gave informed consent.
Method
The study period of 18 days was divided into two time-intervals, i.e. baseline (0days) to 7 th day, with a washout period of 4 days followed by second time interval of 7 days. The use of ozone and CHX irrigation was randomized. Both the patient and the clinician evaluating the clinical parameters were blinded regarding the type of irrigation used.
Treatment procedure
A split-mouth design was used in this study for subgingival irrigation of each half of the mouth with either ozone or chlorhexidine at different time intervals. At baseline and on the 7 th day, the clinical parameters, viz. Plaque Index (Silness and Loe, 1964), Gingival Index (Loe and Silness, 1963) and Gingival Bleeding Index (Ainamo & Bay, 1975), were recorded and the subgingival pooled plaque sample was collected from the selected sites. Later, one-half of the mouth (upper and lower quadrants) was irrigated either with 2% CHX solution via a magnetostrictive ultrasonic insert with a medium-power setting (Dentsply cavitron: DENTSPLY Tulsa Dental Specialties, DENTSPLY (International), 5100 E. Skelly Dr. Ste (300) Tulsa, OK 74135, USA ) or ozonated water was delivered using a modified needle attached to an irrigation device, "Kent ozone dental jet TY-820" (Kent Dental Care Products, USA). After a washout period of 4 days, the clinical parameters were re-assessed and the pooled plaque samples were collected from the irrigation sites. The contralateral side of the mouth was subjected to irrigation in the second interval. The procedure of clinical assessment and collection of pooled plaque sample were repeated on the 18 th day.
Ozone irrigation
The patients were subjected to oral irrigation with ozonated water that was released from an irrigation device, "Kent ozone Dental Jet TY-820" (Kent Dental Care Products), to the selected one-half of the mouth.
The device released a single pulsating stream of ozonated water from the nozzle, which could be adjusted for different speeds and pressures ranging from 350 to 500 kPa (kilo pascals) and an ozone output of 0.082 mg/h, at a noise output of <70 dB (decibels) and water outflow of ≥450 ml. To facilitate subgingival ozone irrigation, a 20-gauge blunt needle was bent and attached to the tip of the nozzle of the ozone dental jet holder. The needle was inserted 3 mm subgingivally and irrigated with ozonated water. A total time of 5-10 min was spent for irrigation of the split-mouth sites.
Chlorhexidine irrigation
The sites on the other half of the mouth were irrigated with a commercially available 0.2% CHX solution (ORinse; Centaur Pharmaceuticals Pvt. Ltd., Mumbai, India) delivered via a magnetostrictive ultrasonic insert (Dentsply Cavitron 25K FSI-1000-62: DENTSPLY Tulsa Dental Specialties, DENTSPLY (International), 5100 E. Skelly Dr. Ste (300), Tulsa, OK 74135, USA ) with a medium power setting. A total time of 5-10 min was spent for irrigation of the split-mouth sites.
Patient instructions
After irrigation, the patients were instructed to perform regular oral hygiene habits, i.e. twice-daily brushing by "roll-on technique" for a minimum of 2 min, using a standard tooth brush (Colgate Super Flexible with medium consistency bristles) and tooth paste (Colgate dental cream) provided to them. The patients were dispersed and instructed to report on the subsequent 7 th day.
Microbial analysis
The pooled plaque samples collected in Eppendorf vials containing transport media, viz. TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8) and Thioglycolate broth were sent to the microbiological laboratory within 24 h of collection, where they were subjected to multiplex polymerase chain reaction (PCR) analysis and culture tests. The following bacteria and viruses were analyzed by PCR analysis:
Bacteria - Aggregatibacter actinomycetemcomitans (Aa)
Porphyromonas gingivalis (Pg)
Tannerella forsythensis (Tf)
Viruses - Herpes simplex virus (HSV-1 and 2)
Epstein Barr virus (EBV)
Human cytomegalovirus (HCMV)
Fungus - Candida albicans was analyzed by culture technique using Sabouraud's agar medium
Laboratory procedures
Processing of samples
The samples, on receipt in the laboratory, were stored at -20°C until DNA extraction and multiplex PCR were performed.
DNA extraction
- The specimen was centrifuged at 10000 rpm in the Eppendorf vial.
- The deposit was washed at least three times with 0.5 ml of TE buffer. Washing was performed by centrifugation at 10,000 rpm for 5 min each time and discarding the supernatant.
- The deposit was treated with 0.5 ml of lysis buffer 1 (Tris-EDTA and 0.5% Triton-X 100 as lysis agent) for 5 min after proper mixing.
- The sample was further centrifuged at 10,000 rpm, the supernatant was discarded and 50 μl of Lysis buffer 2 and freshly prepared Proteinase K solution with a final concentration of 100 μg/ml were also added.
- The tube was kept at 65°C for 2 h in a water bath for Proteinase K to act on and digest the protein.
- After this, the sample was exposed to 95°C for 10 min to destroy the Proteinase K.
- Extracted DNA was kept at -20°C until further processing by PCR.
Primers
The following oligonucleotide primers were used from 5 ' to 3 ' :
HSV-1:
H 1 P 32 with a sequence, TGGGACCATGCCTTCTTGG at primer position 6621-6640.
H1M32 with a sequence, ACCCTTAGT CAGACTCTGTTACTTACCC at primer position 6741-6768.
HSV-2:
H2M40 with a sequence, GTACAGACCTTCGGAGG at primer position 56320-56336.
H2P4 with a sequence, CGCTTCATCATGGGC at primer position 56533-56547.
HCMV:
CP 15 with a sequence, GTACACGCACGCTGGTTACC at primer position 8868-8887.
CM3 with a sequence, GTAGAAAGCCTCGACATCGC at primer position 9105-9124.
EBV:
EP5 with a sequence, AACATTGGCAGCAGGTAAGC at primer position 775-794.
EM3 with a sequence, ACTTACCAAGTGTCCATAGGAGC at primer position 935-957.
Aa:
With a sequence, CAGCAAGCTGCACAGTTTGCAAA.
Pg:
With a sequence, AGGCAGCTTGCCATAATGCG and ACTGTTAGCAACTACCGATGT.
Tf:
With a sequence, TACAGGGGAATAAAATGAGATACG and ACGTCATCCCCACCTTCCTC.
DNA amplification using multiplex PCR
To optimize the multiplex PCR, a series of titrations of primer concentrations and deoxynucleotide triphosphate (dNTP) levels were performed.
Primer concentrations of 10, 25, 50 and 100 pmol from each primer pair were titrated simultaneously with dNTP (0.1, 0.2 and 0.3 mM concentrations of each of the dNTPs.).
The amplification was carried out in 40 cycles of 30 s at 94°C, 40 s at 60°C and 50 s at 72°C in a 50-μl final volume containing 5 μl of 10x reaction buffer (Stratagene, La Jolla, CA, USA), 0.2 mM concentrations of each dNTP, 10 pmol of each of the seven primers and 2.5 U of cloned Pfu DNA polymerase (Stratagene). Five microliters of the appropriate DNA sample was added to the reaction mixture. After the last cycle, the samples were incubated for 15 min at 78°C to complete the extension of primers.
After DNA amplification by PCR, the visualization and analysis of the PCR products was carried out by 2% agarose in Tris-acetate EDTA buffer with 5 μg/ml of ethidium bromide. The samples were subjected to electrophoresis for a minimum of 2 h at a current of 16 volts/gel, with each batch molecular weight standard also run for comparison along with it. After this the gel was exposed to a UV light transilluminator (DNR Bioimaging Systems: Biocompare, 395 Oyster Point Blvd., #321, South San Francisco, CA 94080, United States of America) in a dark room and the image was captured with a digital camera for further analysis. The various microorganisms were identified based on the formation of bands in the form of ladders in the captured image.
Culture technique for Candida albicans
The pooled plaque samples that was in vials containing thioglycolate broth were transported to Sabouraud's agar medium.
The samples were incubated in Sabouraud's medium at 37°C for 48 h and were observed for colony growth. The medium was then stained using Gram's stain and the yeast cells were identified. Large Gram-positive oval to circular cells are diagnostic of yeast cells.
Confirmation test (Germ tube method): Saline and human serum was inoculated on the colonies for a few hours. Presence of Candida albicans could be visualized in a light microscope as hyphae without constriction at their bases.
Statistical analysis
Results were expressed as mean±SD and proportions as percentages. Intragroup comparisons were made by paired t-test and unpaired t-test for intergroup comparisons. Categorical data were analyzed by Fisher's exact test.
For all the tests, a P-value of 0.05 or less was considered for statistical significance.
| Results | | |
The results of the study are reported in [Table 1],[Table 2],[Table 3],[Table 4],[Table 5],[Table 6]. The interpretation of clinical and microbial data is from baseline to 7 th day. The higher percentage of Plaque Index (12%), Gingival Index (29%) and Bleeding Index (26%) reduction was observed using ozone irrigation as compared to chlorhexidine. The percentile reduction of Aa (25%) using ozone was appreciable as compared to no change in Aa occurrence using chlorhexidine. By using O 3 and chlorhexidine, there was no antibacterial effect on Pg and Tf. The antifungal effect of ozone from baseline (37%) to 7 th day (12.5%) was pronounced during the study period, unlike CHX, which did not demonstrate any antifungal effect. The antiviral effect of ozone was not seen for HSV-1, HCMV and EBV. Chlorhexidine proved different by exhibiting an antiviral effect against HSV-1 and HCMV. The HSV-2 was not found in any of the subgingival plaque samples. | Table 3 :Comparison of mean values of Gingival Bleeding Index (% of sites)
Click here to view |
 | Table 4 :Comparison of occurrence of various bacteria at different time intervals
Click here to view |
 | Table 5 :Comparison of occurrence of fungus at different time intervals
Click here to view |
 | Table 6 :Comparison of occurrence of viruses at different time intervals
Click here to view |
The percentage of occurrence of Pg, Tf and HSV-1 was higher on the fourth day, which returned to baseline value on the 7 th day, using ozone irrigation. In the chlorhexidine group, the percentage of Pg was higher, which, however reached baseline levels on the 7 th day, but the percentages of Tf and EBV were lower on the 4 th day and reached the baseline levels.
| Discussion | | |
In the 1998 European Workshop on mechanical plaque control, a policy statement was adopted that states, "Forty years of experimental research, clinical trials and demonstration projects in different geographical and social settings have confirmed that effective removal of dental plaque is essential to dental and periodontal health throughout life." Therefore, the principal objective of periodontal therapy is to eliminate the subgingival bacterial presence and, by subsequent supragingival plaque control measures, prevent or minimize recolonization of the subgingival area by pathogenic microflora. Elimination of the subgingival microflora may be achieved mechanically. The mechanical methods of plaque removal can also be supplemented by antimicrobial agents.
The most common method for controlling the growth of dental plaque is mechanical. However, the effectiveness of this method is limited by such factors as individual motivation, inaccessibility to periodontal pockets, concave tooth surfaces and the margins of restorations. Alternatives to mechanical plaque control are therefore being sought. Chlorhexidine has emerged as an important oral antibacterial agent and adjunct to periodontal therapy. It is a broad-spectrum antiseptic with pronounced antimicrobial effects on Gram-positive as well as Gram-negative bacteria, some viruses and fungi. [3],[4]
An extensive review of the English literature has not revealed previous attempts to control the formation and development of plaque in vivo by delivery of gases to the region. Gases may be more advantageous for use intraorally than liquids because of their different physical characteristics and diffusion potentials. Socransky reviewed the possible pathogenic role of anaerobic bacteria isolated from dental plaques associated with periodontal lesions. Oxygen has been used in the past for delivery into the periodontal pockets as few reports have linked the presence of obligate anaerobic organisms in the dental plaque. But, it was shown that direct oxygen gas application has no effect on plaque formation. [6] In contrast, another experiment conducted to assess the effect of repeated subgingival oxygen irrigations in previously untreated periodontal pockets has shown a significant clinical improvement of the periodontal baseline conditions. [10]
Apart from direct oxygen irrigation, a few oxygenating agents such as sodium monohydrate, sodium monoxychlorosene, carbamide peroxide and sodium borate peroxyhydrate were applied to areas of wounded rat oral tissue. All of these showed complete healing in a shorter time than normally required. [14] Recently, an allotropic form of oxygen, ozone, is being used in dentistry for the treatment of dental caries. Ozone gas application for a period of 10 s was capable of reducing the numbers of microorganisms associated with primary root carious lesions in vitro. [11] Four in vitro studies have reported the antimicrobial effect of ozonated water. Ozonated water has been shown to be effective against Candida albicans, adhering to acrylic denture plates, [15] on Enterococcus faecalis [16] and Streptococcus mutans nal tubules [17] and periodontopathic bacteria such as Aa and Pg in vitro. [12] Ozonated water has also been shown to be effective on root surfaces after extraoral rinsing for decontamination of avulsed teeth in vitro. [18]
Although there are studies related to the use of ozonated water on oral microorganisms in vitro, no literature exists till date on the in vivo effect of ozonated water on oral and, in particular, periodontopathic microorganisms. Ozone is a selective oxidant and effects only certain compounds, but when it dissolves in water, it becomes highly unstable and rapidly decomposes through a complex series of chain reactions. [19],[20] As a result, hydroxyl (OH) radicals are generated, which are among the most reactive oxidizing species. Ozone reacts with various chemical compounds in aqueous systems in two different and coexisting modes, one involving direct reactions of molecular ozone and the other a free radical-mediated reaction. [21] Both these mechanisms may be involved in the destruction of bacteria by ozone.
In this study, chronic periodontitis patients were selected as the above-mentioned periodontal pathogens have been observed in both the disease entities. [22] Owing to the small sample size, chronic and aggressive periodontitis was grouped as periodontitis patients for statistical and discussion purposes. [23] In this preliminary trial, the primary focus was to evaluate the efficacy of ozone on specific microorganisms present in subgingival plaque with single irrigation of ozone during the short period of 7 days. This short-term study was followed based on a study in which analysis of the survival of selected periodontal pathogens after scaling and rootplaning (SRP) and intrapocket irrigation was performed after 1 week and 1 month. [24]
There are several ways of delivering chemical agents. One of the ways such as the subgingival irrigation interferes with the complex ecosystem required for the initiation and continued destruction of the compromised periodontium in the susceptible host. The effects of irrigation on gingival bleeding and plaque include change in plaque composition, flushing out of inflammation-inducing factors and physical change in tissue integrity. [25]
In the present study, the percentage reduction of plaque index was higher in the ozone (12%) group as compared to the CHX (4%) group. The single subgingival irrigation of 0.12% CHX showed significant reduction of Plaque Index at the end of 1 week. [14],[26],[27] The single subgingival irrigation of 0.12% CHX and twice-daily irrigations with 0.12% CHX, while assessing the clinical and microbiological parameters at the end of weeks 1, 2, 4, 6, 8, 10 and 12, demonstrated a reduction in the Gingival Index from baseline to 1 week. This was also in accordance with the study of Lander et al., who had determined the effect of a single subgingival irrigation of 0.2% CHX at baseline and at weeks 1, 2, 3, 4, 5, 7 and 10, and had shown a reduction in the Gingival Index from baseline to 1 week. [14]
There was significant reduction of Gingival Index (29%) and Bleeding Index (26%) in the ozone group as compared to the CHX group. Another study reported the significant clinical improvement of the periodontal baseline conditions after the repeated subgingival oxygen irrigations in previously untreated periodontal pockets. [10]
The antibacterial efficacy of ozone using PCR demonstrated the reduction of Aa (50%) whereas no changes were observed for Pg and Tf on the 7 th day. The chlorhexidine group revealed no changes in the presence of Aa, Pg and Tf. A study that tested the efficacy of intrapocket irrigation with CHX 0.12% and SRP at baseline, 1 week and 1 month, on clinical parameters and microbiological profile, demonstrated a reduction in the percentage of sites that harbored Aa and Pg from baseline to 1 week. [19] Similar reduction in Aa and Pg was reported using CHX chip. [26]
Recently, it has been shown that ozonated water was highly effective in killing both Gram-positive and Gram-negative oral microorganisms like Streptococci, Pg, P. endodontalis and Candida albicans in vitro. The number of viable S. mutans remarkably decreased when treated with ozonated water and it also inhibited the accumulation of experimental dental plaque in vitro. When the dental plaque samples from human subjects were exposed to ozonated water in vitro, almost no viable bacterial cells were detected. Hence, it was suggested that ozonated water should be useful in reducing the infections caused by oral microorganisms in dental plaque. [12] Moreover, the susceptibility of bacterial phenotypes in biofilms is different to those planktonic phenotypes. [24]
The effect of ozone on Candida albicans (12.5%) was noticeable as compared to chlorhexidine, which did not demonstrate an antifungal effect. The viable Candida albicans were nearly non-existent after the application of ozonated water (2-4 mg/l) for 1 min on the denture plates. [17] This study result is not in agreement with the study results of Ellepola et al., which showed that CHX had an anti-Candidal effect. [5]
The antiviral effect of chlorhexidine was pronounced in terms of %reduction of HCMV (12.5%) and EBV (0%) as compared to ozone. In the present study, ozone did not demonstrate the antiviral effect. Bernstein et al. assessed the in vitro virucidal effectiveness of 0.12% CHX mouthrinse on several viruses of the oral cavity and showed that 0.12% CHX had shown a reduction of HSV-1 and HCMV when exposed for 30 s, 5 min and 15 min. [4]
The percentage of occurrence of Pg, Tf and HSV-1 was higher on the fourth day, which returned to baseline value on the 7 th day, using ozone irrigation. In the chlorhexidine group, the percentage of Pg was higher, which, however reached baseline levels on the 7 th day, but the percentage of Tf and EBV was lower on the 4 th day and reached the baseline levels.
The possible explanation of variation in occurrence of microorganisms during study trial (4 th -7 th day) could be attributed to the antibacterial activity of the agent used. Secondly, the PCR technique can detect both viable and non-viable bacteria. Thus, the diagnostic importance of PCR is immeasurable. If the non-viable microorganisms are detected following antimicrobial therapy then the effectiveness of the antimicrobial agent is difficult to assess, i.e. prognostic value of PCR is compromised because it detects even non-viable organisms. In such a case, the culture method is still the gold standard.
In the present trial, ozonated water irrigation showed a similar effect as compared to the widely used chlorhexidine technique in periodontitis. The plaque, gingival inflammation and bleeding reduction were higher in the ozone group. The antibacterial and antifungal efficacy of ozone on Aa and Candida albicans was appreciable. No antiviral property of ozone was observed. The antiviral efficacy of chlorhexidine was better than that of ozone. Despite the substantivity of chlorhexidine, the single irrigation of ozone is quite effective. Ozone has shown better effects than chlorhexidine, except for the antiviral property. The disadvantages of CHX such as taste alteration and staining are potential drawbacks of chlorhexidine. Although PCR was a choice in this study, the culture technique should be used further so that live bacterial estimation should be fruitful. [28] Considering the limitation of this study in terms of short-term duration, ozone can be considered as a promising antimicrobial agent in the periodontal therapy. Further long-term studies are required to adequately assess the efficacy of ozone in vivo and to evaluate the frequency and duration of application of ozone. It is required to determine the specific ozone concentration that is effective against anaerobic periodontopathogens. [29] Because the purpose of this preliminary trial was to study the effect of ozone on few of the periodontopathogens from active deep periodontal pockets of periodontitis patients, pooled plaque samples were collected from the selected sites. [20],[21] However, site-specific studies are more relevant. It can be concluded that local ozone application can serve as a potential agent to treat periodontal disease non-surgically both for home care and for professional practice. It may serve as a good tool during supportive periodontal therapy.
The one drawback of ozone is its unstable nature. The absorbance of ozone in the water increased almost linearly with time, from 5 to approximately 60 s (data not shown). The stability of ozone in the water was low and ozone dissipated very quickly in ozone demand free water at room temperature over 5 min, which was in agreement with Shechter. [30],[31]
| Conclusion | | |
As an alternative management strategy, ozone may be considered due to its powerful ability to inactivate microorganisms. There is growing evidence that it can be employed as a useful therapeutic agent to treat bacteria-, virus- and fungus-associated periodontitis both for home care and at the professional level.
| References | | |
| 1. | Cappuyns I, Gugerli P, Mombelli A. Viruses in periodontal disease: A review. Oral Dis 2005;11:219-29.  [PUBMED] [FULLTEXT] |
| 2. | Jarvensivu A, Hietanen J, Rautemaa R, Sorsa T, Ricardson M. Candida yeasts in chronic periodontitis tissues and subgingival microbial biofilms in vivo. Oral Dis 2004;10:106-12. |
| 3. | Bernstein D, Schiff G, Echler G, Purice A, Feller M, Briner W. In vitro virucidal effectiveness of a 0.12% chlorhexidine gluconate mouth rinse. J Dent Res 1990;69:874-6. |
| 4. | Ellepola AN, Samaranayake LP. Adjunctive use of chlorhexidine in oral candidoses: A review. Oral Dis 2001;7:11-7. [PUBMED] [FULLTEXT] |
| 5. | Marsh PD. Sugar, fluoride, pH and microbiota homeostasis in dental plaque. Proc Finn Dent Soc 1991;87:515-25. [PUBMED] |
| 6. | Wilson M, Gibson M, Strahan D, Harvey W. A preliminary evaluation of the use of redox agent in the treatment of chronic periodontitis. J Periodont Res 1992;27:522-7. [PUBMED] |
| 7. | Marsh PD. Microbial ecology of dental plaque and its significance in health and disease. Adv Dent Res 1994;8:263-71. [PUBMED] [FULLTEXT] |
| 8. | Mettraux GR, Gusberti FA, Graf H. Oxygen tension (pO 2 ) in untreated human periodontal pockets. J Clin Periodontol 1984;55:516-21. |
| 9. | Hirsch RS, Clarke NG, Townsend GC. The effect of locally released oxygen on the development of plaque and gingivitis in man. J Clin Periodontol 1981;8:21-8. [PUBMED] |
| 10. | Guentherman RH, Bishop JG, Collings KC, Dorman HL. The effect of increased blood oxygen tensions on induced periodontal disease. J Periodontol 1972;43:233-6. [PUBMED] |
| 11. | Wennstrom J, Lindhe J. Effect of hydrogen peroxide on developing plaque and gingivitis in man. J Clin Periodontol 1979;6:115-30. |
| 12. | Schlagenhauf U, Horlacher V, Netuschil L, Brecx M. The effect of repeated subgingival oxygen irrigations in previously untreated deep periodontal pockets. J Clin Periodontol 1994;21:48-50. [PUBMED] |
| 13. | Baysan A, Whiley RA, Lynch E. Antimicrobial effect of a novel ozone-generating device on microorganisms associated with primary root carious resins in vitro. Caries Res 2000;34:498-501. [PUBMED] [FULLTEXT] |
| 14. | Lander PE, Newcomb GM, Seymour GJ, Powerll RN. The antimicrobial and clinical effects of a single subgingival irrigation of CHX in advanced periodontitis lesions. J Clin Periodontol 1986;13:74-80. |
| 15. | Arita M, Nagayoshi M, Fukuizumi T, Okinaga T, Masumi S, Morikawa M, et al. Micorbicidal efficacy of ozonated water against Candida albicans adhering to acrylic denture plates. Oral Microbiol Immunolth 2005;20:206-10. |
| 16. | Hems RS, Gulabivala K, Ng YL, Ready D, Spratt A. An in vitro evaluation of the ability of ozone to kill a strain of Enterococcus faecalis. Int Endod J 2005;38:22-9. |
| 17. | Nagayoshi M, Kitamura C, Fukuizumi T, Nishihara T, Terashita M. Antimicrobial effect of ozonated water on bacteria invading dentinal tubules. J Endod 2004;30:778-81. [PUBMED] [FULLTEXT] |
| 18. | Ebensberger V, Pohl Y, Filippi A. PCNA expression of cementoblasts and fibroblasts on the root surface after extraoral rinsing for decontamination. Dent Traumatol 2002;18:262-6. |
| 19. | Hoigne J, Bader H. The role of hydroxyl radical reactions in ozonation processes in aqueous solutions. Water Res 1976;10:377-86. |
| 20. | Shin WT, Mirmiran A, Yiacoumi S, Tsouris C. Ozonation using micro bubbles formed by electric fields. Separat Purif Technol 1999;15:271-82. |
| 21. | Staehelin J, Hoigne. Decomposition of ozone in water in the presence of organic solutes acting as promoters and inhibitors of radical chain reactions. Environ Sci Technol 1985;19:1206-13. |
| 22. | Newman MG, Takei HH, Carranza FA. Clinical Periodontology. 9 th ed. Philadelphia: Saunders; 2003. |
| 23. | Vandana KL, Shah K, Prakash S. Clinical and radiographic evaluation of emdogain as a regenerative material in the treatment of interproximal vertical defects in chronic and aggressive periodontitis patients. Int J Periodontics Restorative Dent 2004;24:185-91. [PUBMED] |
| 24. | Shiloah J, Patters MR. DNA probe analyses of the survival of selected periodontal pathogens following scaling, root planing and intra-pocket irrigation. J Periodontol 1994;65:568-75. [PUBMED] |
| 25. | Brownstein CN, Briggs SD, Schweitzer KL, Briner WW, Kornman KS. Irrigation with chlorhexidine to resolve naturally occurring gingivitis. A methodologic study. J Clin Periodontol 1990;17:588-93. [PUBMED] |
| 26. | Stabholz A, Nicholas AA, Zimmerman GJ, Wikesjou ME. Clinical and antimicrobial effects of a single episode of subgingival irrigation with tetracycline HCl or CHX in deep periodontal pockets. J Clin Periodontol 1998;25:794-800. |
| 27. | Daneshmand N, Jorgensen MG, Nowzari H, Morrison JL, Slots J. Initial effect of controlled release chlorhexidine on subgingival microorganisms. J Periodont Res 2002;37:375-9. [PUBMED] [FULLTEXT] |
| 28. | Boutaga K, Wilkenhoff AJ, Vandenbrouckegrauls CM, Savelkoul PH. Comparison of real- time PCR and culture for detection of porphyromonas gingivalis in subgingival plaque samples. J Clin Microbiol 2003;41:4950-4. |
| 29. | Manhold JH, Weisinger E, Rustogi K. Gingival tissue oxygenation: The effect of daily application of four commercial preparations. J Periodontol 1974;45:312-3. [PUBMED] |
| 30. | Wilson M. Susceptibility of oral bacterial biofilms to antimicrobial agents. J Med Microbiol 1996;44:79-87. [PUBMED] [FULLTEXT] |
| 31. | Shechter H. Spectrophotometric method of determination of ozone in aqueous solutions. Water Res 1973;7:729-39. |
Correspondence Address:
Vandana K Laxman
Department of Periodontics, College of Dental Sciences, Davangere, Karnataka
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/0970-9290.70796
[Table 1], [Table 2], [Table 3], [Table 4], [Table 5], [Table 6] |
|
| This article has been cited by | | 1 |
Clinical Efficacy of Ozonated Water and Photodynamic Therapy in Non-Surgical Management of Chronic Periodontitis: A Clinico- Microbial Study |
|
| Roopanshi Mehrotra, Sanjay Gupta, Zeba Rahman Siddiqui, Deepti Chandra, SK Aziz Ikbal | | Photodiagnosis and Photodynamic Therapy. 2023; : 103749 | | [Pubmed] | [DOI] | | | 2 |
Effectiveness of ozone therapy in the treatment of periodontal diseases: a systematic review |
|
| Pamella Valente PALMA, Rafaela de Oliveira CUNHA, Isabel Cristina Gonçalves LEITE | | RGO - Revista Gaúcha de Odontologia. 2023; 71 | | [Pubmed] | [DOI] | | | 3 |
Ozone – A versatile therapy in implant dentistry |
|
| Apoorva Salve, Salman Ansari, Deepti Gattani, Nupur Kar, Prajakta Heda | | Journal of Global Oral Health. 2023; 5: 124 | | [Pubmed] | [DOI] | | | 4 |
Ozonized hydrogels for clinical and domiciliary management in periodontal regenerative therapy an annotation |
|
| Shivani Sachdeva, Amit Mani, Harish Saluja | | Journal of Cellular Biotechnology. 2023; : 1 | | [Pubmed] | [DOI] | | | 5 |
Ozonized Hydrogels vs. 1% Chlorhexidine Gel for the Clinical and Domiciliary Management of Peri-Implant Mucositis: A Randomized Clinical Trial |
|
| Andrea Butera, Maurizio Pascadopoli, Simone Gallo, Carlos Pérez-Albacete Martínez, José Eduardo Maté Sánchez de Val, Luca Parisi, Alice Gariboldi, Andrea Scribante | | Journal of Clinical Medicine. 2023; 12(4): 1464 | | [Pubmed] | [DOI] | | | 6 |
Is Ozone a Valid Adjuvant Therapy for Periodontitis and Peri-Implantitis? A Systematic Review |
|
| Francesco D'Ambrosio, Mario Caggiano, Alfonso Acerra, Massimo Pisano, Francesco Giordano | | Journal of Personalized Medicine. 2023; 13(4): 646 | | [Pubmed] | [DOI] | | | 7 |
Administration of Clinical COVID-19 Mouthwashing Protocol and Potential Modulation of Pediatric Oral Bacterial Prevalence of Selenomonas noxia: A Pilot Study |
|
| Praneeti Sodhi, Yuxin Jiang, Summer Lin, Jackson Downey, Chase Sorenson, Melika Shayegh, Victoria Sullivan, Karl Kingsley, Katherine M. Howard | | Pediatric Reports. 2023; 15(3): 414 | | [Pubmed] | [DOI] | | | 8 |
Effect of ozone irrigation and powered toothbrushing on dental plaque, gingival inflammation, and microbial status in institutionalized mentally challenged individuals: A double-blinded, randomized, controlled clinical trial |
|
| Pramod Vinayak Tatuskar, Shaswata Karmakar, Narayan Narendra Walavalkar, Kharidhi Laxman Vandana | | Journal of Indian Society of Periodontology. 2023; 27(3): 315 | | [Pubmed] | [DOI] | | | 9 |
Ozone Therapy in the Management and Prevention of Caries |
|
| AbdulMajeed A AlMogbel, Maram I Albarrak , Shahad F AlNumair | | Cureus. 2023; | | [Pubmed] | [DOI] | | | 10 |
Ozone in Patients with Periodontitis: A Clinical and Microbiological Study |
|
| Ana Maria Ramirez-Peńa, Arturo Sánchez-Pérez, Matilde Campos-Aranda, Francisco Javier Hidalgo-Tallón | | Journal of Clinical Medicine. 2022; 11(10): 2946 | | [Pubmed] | [DOI] | | | 11 |
Effects of an Ozonated Water Irrigator on the Plaque Index and Bleeding Index of Pregnant Women |
|
| Simona Tecco, Alessandro Nota, Teresa D’Amicantonio, Laura Pittari, Marika Monti, Elisabetta Polizzi | | Journal of Clinical Medicine. 2022; 11(14): 4107 | | [Pubmed] | [DOI] | | | 12 |
Treatment of aggressive periodontitis with photodynamic therapy and ozonated water irrigation as an adjunct to scaling and root planing: A case report |
|
| Sheikh Aziz Ikbal, Zeba Rahman Siddiqui, Roopanshi Mehrotra, Sapna Ahlawat | | Asian Journal of Oral Health and Allied Sciences. 2022; 12: 4 | | [Pubmed] | [DOI] | | | 13 |
Evaluation of ozone oil irrigation as an adjunct to SRP in the treatment of chronic periodontitis – A randomized clinical trial |
|
| Palak Sharma, Nupoor Khiraiya, Gazala Kareem, Swati Raj, Abhishek Agrawal, Tarun Kumar Bhatnagar, Ritunja Singh | | Journal of Global Oral Health. 2022; 0: 1 | | [Pubmed] | [DOI] | | | 14 |
Ozone Gel in Chronic Periodontal Disease: A Randomized Clinical Trial on the Anti-Inflammatory Effects of Ozone Application |
|
| Marco Colombo, Simone Gallo, Alessandro Garofoli, Claudio Poggio, Carla Renata Arciola, Andrea Scribante | | Biology. 2021; 10(7): 625 | | [Pubmed] | [DOI] | | | 15 |
Efficacy of gaseous ozone in smoking and non-smoking gingivitis patients |
|
| Ahmet Cemil Talmaç, Metin Çalisir | | Irish Journal of Medical Science (1971 -). 2021; 190(1): 325 | | [Pubmed] | [DOI] | | | 16 |
A Comparative Study of Pain and Healing in Post-Dental Extraction Sockets Treated with Ozonated Water/Oil and Normal Saline |
|
| Abhishek Vamshi Kogila, Kishore M, Padma Rayulu K, B. H. R. K. Raju, David Tyro, Arun Bhupathi | | Journal of Maxillofacial and Oral Surgery. 2021; | | [Pubmed] | [DOI] | | | 17 |
Antibiofilm effect of ozonized physiological saline solution on peri-implant–related biofilm |
|
| Caroline C. Tonon, Beatriz H. D. Panariello, Denise M. P. Spolidorio, Ana G. Gossweiler, Simone Duarte | | Journal of Periodontology. 2021; 92(8): 1151 | | [Pubmed] | [DOI] | | | 18 |
Effect of Ozonated Water on Oral Mucositis and Pain Induced by Head and Neck Radiotherapy: A Cross-sectional Study |
|
| Farzad Ghorbani, Mohsen Yazdanian, Elahe Tahmasebi, Morteza Izadi, Bahram Mofid, Hesam Aldin Varpaei | | Archives of Neuroscience. 2021; 8(4) | | [Pubmed] | [DOI] | | | 19 |
Comparison of shear bond strength as affected by ozonated water, fluoride varnish & casein phosphopeptide – Amorphous calcium phosphate |
|
| Jejo Mathew, Reena R Kumar | | IP Indian Journal of Orthodontics and Dentofacial Research. 2020; 6(2): 76 | | [Pubmed] | [DOI] | | | 20 |
Assessment of the Efficacy of Various Subgingival Irrigating Solutions in Chronic Periodontitis: A Comparative Study
|
|
| Narendra V Penumatsa, Abdulfatah Alazmah, Mohammad Jalaluddin, Prashant Punde, Shilpa Mailankote | | World Journal of Dentistry. 2020; 11(3): 221 | | [Pubmed] | [DOI] | | | 21 |
Bio-Inspired Systems in Nonsurgical Periodontal Therapy to Reduce Contaminated Aerosol during COVID-19: A Comprehensive and Bibliometric Review |
|
| Andrea Butera, Carolina Maiorani, Valentino Natoli, Ambra Bruni, Carmen Coscione, Gaia Magliano, Giulia Giacobbo, Alessia Morelli, Sara Moressa, Andrea Scribante | | Journal of Clinical Medicine. 2020; 9(12): 3914 | | [Pubmed] | [DOI] | | | 22 |
Ozonoterapia como adyuvante en el tratamiento periodontal no quirúrgico y quirúrgico |
|
| María Gabriela Chapa-Arizpe, María de los Ángeles Andrea Carvajal-Montes de Oca, Gloria Martínez-Sandoval, Rubén Gerardo Lozano-Belaunzarán, Jorge Luis Salazar-Leal | | Revista de la Asociación Dental Mexicana. 2020; 77(5): 267 | | [Pubmed] | [DOI] | | | 23 |
Ineffectiveness of ozone therapy in nonsurgical periodontal treatment: a systematic review and metaanalysis of randomized clinical trials |
|
| Vittorio Moraschini, Ingrid Chaves Cavalcante Kischinhevsky, Monica Diuana Calasans-Maia, Jamil Awad Shibli, Suelen Cristina Sartoretto, Carlos Marcelo Figueredo, José Mauro Granjeiro | | Clinical Oral Investigations. 2020; 24(6): 1877 | | [Pubmed] | [DOI] | | | 24 |
Ozone application as adjunctive therapy in chronic periodontitis: Clinical, microbiological and biochemical aspects |
|
| Ahu Uraz,Burcu Karaduman,Sila Çagri Isler,Sevim Gönen,Deniz Çetiner | | Journal of Dental Sciences. 2019; 14(1): 27 | | [Pubmed] | [DOI] | | | 25 |
Ozone application as adjunctive therapy in chronic periodontitis: Clinical, microbiological and biochemical aspects |
|
| Ahu Uraz,Burcu Karaduman,Sila Çagri Isler,Sevim Gönen,Deniz Çetiner | | Journal of Dental Sciences. 2019; 14(1): 27 | | [Pubmed] | [DOI] | | | 26 |
Effectiveness of the adjunctive use of ozone and chlorhexidine in patients with chronic periodontitis |
|
| Kaveri Kranti Gandhi, Emil G. Cappetta, Rajdeep Pavaskar | | BDJ Open. 2019; 5(1) | | [Pubmed] | [DOI] | | | 27 |
Evaluating clinical and laboratory effects of ozone in non-surgical periodontal treatment: a randomized controlled trial |
|
| Eltas Seydanur Dengizek,Dundar Serkan,Eltas Abubekir,Karabulut Aysun Bay,Otlu Onder,Cicek Arife | | Journal of Applied Oral Science. 2019; 27 | | [Pubmed] | [DOI] | | | 28 |
Antimicrobial Activity of Ozone against Pathogenic Oral Microorganisms on Different Denture Base Resins |
|
| Yeliz Hayran,Sule Tugba Deniz,Ali Aydin | | Ozone: Science & Engineering. 2019; : 1 | | [Pubmed] | [DOI] | | | 29 |
Antimicrobial Activity of Ozone against Pathogenic Oral Microorganisms on Different Denture Base Resins |
|
| Yeliz Hayran,Sule Tugba Deniz,Ali Aydin | | Ozone: Science & Engineering. 2019; : 1 | | [Pubmed] | [DOI] | | | 30 |
Periodontal herpesvirus morbidity and treatment |
|
| Jřrgen Slots,Henrik Slots | | Periodontology 2000. 2019; 79(1): 210 | | [Pubmed] | [DOI] | | | 31 |
Periodontal herpesvirus morbidity and treatment |
|
| Jřrgen Slots,Henrik Slots | | Periodontology 2000. 2019; 79(1): 210 | | [Pubmed] | [DOI] | | | 32 |
Efficacy of Ozonised Water and 0.2% Chlorhexidine Gluconate in the Management of Chronic Periodontitis when Used as an Irrigant in Conjugation with Phase I Therapy |
|
| Shaeesta K Bhavikatti, Amritpal Kaur, Sitansu S Das, Sagar Khanna, Meena Jain, Avineet Kaur | | The Journal of Contemporary Dental Practice. 2019; 20(3): 318 | | [Pubmed] | [DOI] | | | 33 |
Evaluation of the Efficacy of a Single Subgingival Irrigation with Ozonated Water on Gingival Inflammation, Lactate Dehydrogenase Enzyme, and Alkaline Phosphatase Enzyme Activity in GCF in the Subjects undergoing Fixed Orthodontic Appliance Therapy: A Cli |
|
| Ashvini M Padhye, Nrupa C Tambade | | Journal of Contemporary Dentistry. 2018; 8(1): 33 | | [Pubmed] | [DOI] | | | 34 |
The Effect of Ozonated Water and Chlorhexidine Gluconate on Prevention of Ventilator-Associated Pneumonia: A Double-Blind, Randomized, Clinical Trial |
|
| Nasrin Hanifi,Masomeh Masoumi,Mohammad Reza Jamshidi,Soghrat Faghihzadeh | | Iranian Red Crescent Medical Journal. 2017; 19(10) | | [Pubmed] | [DOI] | | | 35 |
The Effect of Ozonated Water and Chlorhexidine Gluconate on Prevention of Ventilator-Associated Pneumonia: A Double-Blind, Randomized, Clinical Trial |
|
| Nasrin Hanifi,Masomeh Masoumi,Mohammad Reza Jamshidi,Soghrat Faghihzadeh | | Iranian Red Crescent Medical Journal. 2017; 19(10) | | [Pubmed] | [DOI] | | | 36 |
Dental applications of ozone therapy: A review of literature |
|
| Sansriti Tiwari,Alok Avinash,Shashank Katiyar,A. Aarthi Iyer,Suyog Jain | | The Saudi Journal for Dental Research. 2017; 8(1-2): 105 | | [Pubmed] | [DOI] | | | 37 |
Dental applications of ozone therapy: A review of literature |
|
| Sansriti Tiwari,Alok Avinash,Shashank Katiyar,A. Aarthi Iyer,Suyog Jain | | The Saudi Journal for Dental Research. 2017; 8(1-2): 105 | | [Pubmed] | [DOI] | | | 38 |
Ozone in Dental Therapy |
|
| Rudrakshi Chickanna | | The Journal of Dentists. 2016; 4(1) | | [Pubmed] | [DOI] | | | 39 |
Dry Socket and the Length of Healing Depending on the Type of the Treatment. Part two: Treatment with Ozonated Water |
|
| J. Mazánek, H. Hubálková, H. Stanková, R. Šmucler, I. Linetskiy, V. Seidler, A. Jedlicková | | Ceská stomatologie/Praktické zubní lékarství. 2016; 116(4): 96 | | [Pubmed] | [DOI] | | | 40 |
Periodontal herpesviruses: prevalence, pathogenicity, systemic risk |
|
| Jřrgen Slots | | Periodontology 2000. 2015; 69(1): 28 | | [Pubmed] | [DOI] | | | 41 |
Periodontal herpesviruses: prevalence, pathogenicity, systemic risk |
|
| Jřrgen Slots | | Periodontology 2000. 2015; 69(1): 28 | | [Pubmed] | [DOI] | | | 42 |
Ozone as an adjunct to conventional nonsurgical therapy in chronic periodontitis: a randomized controlled clinical trial |
|
| R. Al Habashneh,W. Alsalman,Y. Khader | | Journal of Periodontal Research. 2014; : n/a | | [Pubmed] | [DOI] | | | 43 |
Aqueous-ozone irrigation of bone monocortical wounds in hyperglycemic rats |
|
| Alexandre Viana Frascino,Andrea Mantesso,Luciana Corręa,Maria Cristina Zindel Deboni | | Acta Cirurgica Brasileira. 2013; 28(5): 327 | | [Pubmed] | [DOI] | | | 44 |
Aqueous-ozone irrigation of bone monocortical wounds in hyperglycemic rats |
|
| Alexandre Viana Frascino,Andrea Mantesso,Luciana Corręa,Maria Cristina Zindel Deboni | | Acta Cirurgica Brasileira. 2013; 28(5): 327 | | [Pubmed] | [DOI] | | | 45 |
Evaluation of the Clinical and Antimicrobial Effects of the Er:YAG Laser or Topical Gaseous Ozone as Adjuncts to Initial Periodontal Therapy |
|
| Selçuk Yilmaz,Serdar Algan,Hare Gursoy,Ulku Noyan,Bahar Eren Kuru,Tanju Kadir | | Photomedicine and Laser Surgery. 2013; 31(6): 293 | | [Pubmed] | [DOI] | | | 46 |
antimicrobial effect of ozone on cariogenic microorganisms in vitro |
|
| tuncer, d. and yazici, a.r. and ayturan, s. and ozgunaltay, g. and dayangac, b. | | ozone: science and engineering. 2013; 35(6): 456-464 | | [Pubmed] | | | 47 |
Clinical and microbiological effects of ozone nano-bubble water irrigation as an adjunct to mechanical subgingival debridement in periodontitis patients in a randomized controlled trial |
|
| Sae Hayakumo,Shinichi Arakawa,Yoshihiro Mano,Yuichi Izumi | | Clinical Oral Investigations. 2013; 17(2): 379 | | [Pubmed] | [DOI] | | | 48 |
Application of ozone in the treatment of periodontal disease |
|
| Srikanth, A. and Sathish, M. and Harsha, A.V.S. | | Journal of Pharmacy and Bioallied Sciences. 2013; 5(SUPPL.1): S89-S94 | | [Pubmed] | | | 49 |
Aqueous-ozone irrigation of bone monocortical wounds in hyperglycemic rats |
|
| Frascino, A.V. and Mantesso, A. and CorrĂŞa, L. and Deboni, M.C.Z. | | Acta Cirurgica Brasileira. 2013; 28(5): 327-333 | | [Pubmed] | | | 50 |
Ozone and its use in periodontal treatment |
|
| Dimitrios Iliadis,Brian J. Millar | | Open Journal of Stomatology. 2013; 03(02): 197 | | [Pubmed] | [DOI] | | | 51 |
Ozonized Water in Dental Traumatology – A Preliminary Study on the Treatment of Avulsed Teeth,in Vitro |
|
| D. Zimmermann,T. Waltimo,A. Filippi | | Ozone: Science & Engineering. 2012; 34(6): 484 | | [Pubmed] | [DOI] | | | 52 |
Antimicrobial effects of ozonated water on the sanitization of dental instruments contaminated with E. coli, S. aureus, C. albicans, or the spores of B. atrophaeus |
|
| Julio César,Tânia Cristina Sumita,Juliana Campos Junqueira,Antonio Olavo Cardoso Jorge,Marcos Augusto do Rego | | Journal of Infection and Public Health. 2012; 5(4): 269 | | [Pubmed] | [DOI] | | | 53 |
Management of gingival inflammation in orthodontic patients with ozonated water irrigation - a pilot study |
|
| Dhingra, K. and Vandana, K.L. | | International Journal of Dental Hygiene. 2011; 9(4): 296-302 | | [Pubmed] | | | 54 |
Effect of ozone therapy upon clinical and bacteriological parameters of the oral cavity: An update |
|
| González-Muñoz, L. and Flichy-Fernández, A.J. and Ata-Ali, J. and Pascual-Moscardó, A. and Peñarrocha-Diago, M.A. | | Journal of Clinical and Experimental Dentistry. 2011; 3(4): 325-327 | | [Pubmed] | | | 55 |
Effectiveness of ozone against periodontal pathogenic microorganisms |
|
| Karin C. Huth,Martina Quirling,Stefanie Lenzke,Ekaterini Paschos,Klaus Kamereck,Korbinian Brand,Reinhard Hickel,Nicoleta Ilie | | European Journal of Oral Sciences. 2011; 119(3): 204 | | [Pubmed] | [DOI] | | | 56 |
Management of gingival inflammation in orthodontic patients with ozonated water irrigation - a pilot study |
|
| K Dhingra,KL Vandana | | International Journal of Dental Hygiene. 2011; 9(4): 296 | | [Pubmed] | [DOI] | | | 57 |
Management of gingival inflammation in orthodontic patients with ozonated water irrigation - a pilot study |
|
| K Dhingra,KL Vandana | | International Journal of Dental Hygiene. 2011; 9(4): 296 | | [Pubmed] | [DOI] | | | 58 |
|
|
| | | . ; | | [Pubmed] | |
|
|
|
|
|
|
|
|
|
|
|
|
| Article Access Statistics | | | Viewed | 28318 | | | Printed | 1268 | | | Emailed | 32 | | | PDF Downloaded | 1038 | | | Comments | [Add] | | | Cited by others | 58 | | |
|
|
Users online:
